circad | circRNAs associated with diseases

hsa_circ_0072995
Gene	RGNEF	Organism	Human
Genome Locus	chr5:73069679-73076570:+	Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	30182731
Experimental Method
Sample Type	Cell Lines	Comparison	Human breast cancer cell lines MCF-7 and MDA-MB-231
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGAACAGCTATGCCCTCCAG Reverse CCCATCTCATAGCCAGGTGT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhang, HD, Jiang, LH, Hou, JC, Zhou, SY, Zhong, SL, Zhu, LP, Wang, DD, Yang, SJ, He, YJ, Mao, CF, Yang, Y, Wang, JY, Zhang, Q, Xu, HZ, Yu, DD, Zhao, JH, Tang, JH, Ji, ZL (2018). Circular RNA hsa_circ_0072995 promotes breast cancer cell migration and invasion through sponge for miR-30c-2-3p. Epigenomics, 10, 9:1229-1242.